Repbase Reports

2012, Volume 12, Issue 9
September 30, 2012
Copyright © 2001-2016 - Genetic Information Research Institute
ISSN# 1534-830X
Page 1955


R1 non-LTR retrotransposon: consensus.

Key Words:
R1; Non-LTR Retrotransposon; Transposable Element; R1B_DVi
Drosophila virilis
Drosophila virilis
Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Brachycera; Muscomorpha; Ephydroidea; Drosophilidae; Drosophila; virilis group
[2] Authors:
Kojima,K.K. and Jurka,J.
Non-LTR retrotransposons from fruit fly.
Repbase Reports 12(9), 1955-1955 (2012)
>97% identical to consensus. It constitutes tandem arrays with TSDs (ATATGTTTTGTTTTGTCCCTATCTACT) whose last 14-bp sequence is identical to that of typical R1 TSDs. It is more similar to R1_DWi than R1_DVi.
[2] (Consensus)
Download Sequence - Format:
  1. Drosophila 12 Genomes Consortium
    Evolution of genes and genomes on the Drosophila phylogeny.
    Nature 450(7167), 203-218 (2007)

© 2001-2021 - Genetic Information Research Institute