Repbase Reports

2012, Volume 12, Issue 8
August 31, 2012
Copyright © 2001-2016 - Genetic Information Research Institute
ISSN# 1534-830X
Page 1638


Short LTR retrotransposon from the Eutrema parvulum genome: consensus.

Key Words:
LTR Retrotransposon; Transposable Element; LT1_EPa
Eutrema parvulum
Eutrema parvulum
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; rosids; malvids; Brassicales; Brassicaceae; Eutremeae; Eutrema
[2] Authors:
LTR retrotransposons from the Eutrema parvulum genome.
Repbase Reports 12(8), 1638-1638 (2012)
>89% identical to consensus. 5bp TSD. The element is complete, with short internal portion flanked by LTRs. The internal portion: tggtatcagagcccgatccacacactcttgtaatccggcccaaaaagtggtccgtgctcctggacccgaaattgatggtctggcgagattaatggctagaagagccattatctcgagggggag.
[2] (Consensus)
Download Sequence - Format:
  1. Dassanayake,M., Oh,D.H., Haas,J.S., Hernandez,A., Hong,H., Ali,S., Yun,D.J., Bressan,R.A., Zhu,J.K., Bohnert,H.J. et al.
    The genome of the extremophile crucifer Thellungiella parvula.
    Nat Genet 43(9), 913-918 (2011)

© 2001-2021 - Genetic Information Research Institute