Repbase Reports

2012, Volume 12, Issue 10
October 31, 2012
Copyright © 2001-2016 - Genetic Information Research Institute
ISSN# 1534-830X
Page 2273

Tx1-U5-1_SK

A Tx1 non-LTR retrotransposon from Saccoglossus kowalevskii - consensus.

Submitted:
22-Mar-2011
Accepted:
31-Oct-2012
Key Words:
Tx1; Non-LTR Retrotransposon; Transposable Element; Tx1-U5-1_SK
Source:
Saccoglossus kowalevskii
Organism:
Saccoglossus kowalevskii
Taxonomy:
Eukaryota; Metazoa; Hemichordata; Enteropneusta; Harrimaniidae; Saccoglossus
[1] Authors:
Kojima,K.K. and Jurka,J.
Title:
U5 small nuclear RNA gene-specific Tx1 non-LTR retrotransposons from the acorn worm.
Journal:
Repbase Reports 12(10), 2273-2273 (2012)
Abstract:
This consensus is generated from 6 sequences with >98% identity. All copies are followed by U5 small nuclear RNA genes started with TCGCCTTTTACTAAAGATTT, where TC is microhomologies with retrotransposon 3' tail. This sequence was derived from sequence data generated by Human Genome Sequencing Center at Baylor College of Medicine: the acorn worm genome.
Derived:
[1] (Consensus)
Download Sequence - Format:
IG, EMBL, FASTA
References:

© 2001-2021 - Genetic Information Research Institute