Repbase Reports

2008, Volume 8, Issue 11
November 30, 2008
Copyright © 2001-2016 - Genetic Information Research Institute
ISSN# 1534-830X
Page 1746

LTR1_Ttr

Long terminal repeat.

Submitted:
07-Nov-2008
Accepted:
30-Nov-2008
Key Words:
ERV1; Endogenous Retrovirus; Transposable Element; LTR1_Ttr
Source:
Tursiops truncatus
Organism:
Tursiops truncatus
Taxonomy:
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Cetacea; Odontoceti; Delphinidae; Tursiops
[1] Authors:
Jurka,J.
Title:
Long terminal repeats from dolphin.
Journal:
Repbase Reports 8(11), 1746-1746 (2008)
Abstract:
4 bp TSD. It includes a SINE2-like sequence at its 3' end: CTGGTCTAGTGGCTAGGATTCGGTGCTCTCACTGCCGCGACCTGACCT CAATCTCTGGCCGGGAACCGAAACCCTGCTTCAAGCCGCTGCAGGCCGAGGCCACCCGAGATCA.
Derived:
[1] (Consensus)
Download Sequence - Format:
IG, EMBL, FASTA
References:

© 2001-2021 - Genetic Information Research Institute