Repbase Reports

2006, Volume 6, Issue 9
September 30, 2006
Copyright © 2001-2016 - Genetic Information Research Institute
ISSN# 1534-830X
Page 469

hAT-N2A_XT

A nonautonomous family of hAT transposons - a consensus.

Submitted:
29-Sep-2006
Accepted:
30-Sep-2006
Key Words:
hAT; DNA transposon; Interspersed Repeat; Nonautonomous; non-autonomous; hAT-N2_XT; hAT-N2A_XT
Source:
Xenopus tropicalis
Organism:
Xenopus tropicalis
Taxonomy:
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Mesobatrachia; Pipoidea; Pipidae; Xenopodinae; Xenopus; Silurana
[1] Authors:
Kapitonov,V.V. and Jurka,J.
Title:
hAT-N2A_XT, a minisatellite-propagating subfamily of nonautonomous hAT DNA transposons from frog.
Journal:
Repbase Reports 6(9), 469-469 (2006)
Abstract:
The genome contains thousands of copies of the hAT-N2A_XT nonautonomous DNA transposon. These elements have been transposed long time ago (they are >20% divergent from the consensus sequence). This transposon is characterized by 8-bp TSDs and 15-bp TIRs. The hAT-N2A_XT and hAT-N2_XT consensus sequences share the 78% identical 150-bp and 80-bp 5' and 3' termini. Numerous copies of hAT-N2A_XT contain the (TTTTGACGCGACCATGCCCA)n minisatellites.
Derived:
[1] (Consensus)
Download Sequence - Format:
IG, EMBL, FASTA
References:

© 2001-2022 - Genetic Information Research Institute