Repbase Reports

2006, Volume 6, Issue 10
October 31, 2006
Copyright © 2001-2016 - Genetic Information Research Institute
ISSN# 1534-830X
Page 511


Solanum DNA, short interspersed repetitive element, TS family.

Key Words:
SINE; Non-LTR Retrotransposon; Interspersed Repeat; TS2
Solanum demissum
Solanum demissum
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicots; asterids; lamiids; Solanales; Solanaceae; Solanum
[1] Authors:
Shankar,R. and Jurka,J.
TS2: A SINE subfamily from Solanum demissum related to TS.
Repbase Reports 6(10), 511-511 (2006)
This sequence is relatively new. It has got 27 bp long target site sequence (TTGAGACCTCAATAACCATTTATCACA).
[1] (Consensus)
Download Sequence - Format:

© 2001-2020 - Genetic Information Research Institute