Repbase Reports

2003, Volume 3, Issue 6
June 30, 2003
Copyright © 2001-2016 - Genetic Information Research Institute
ISSN# 1534-830X
Page 106


Nonautonomous DNA transposon HAT5N_CI - a consensus.

Key Words:
Nonautonomous DNA transposon, hAT superfamily; 8-bp target site duplication; HAT5; HAT5N_CI
Ciona intestinalis
Eukaryota; Metazoa; Chordata; Urochordata; Ascidiacea; Enterogona; Phlebobranchia; Cionidae; Ciona
[1] Authors:
Kapitonov,V.V. and Jurka,J.
HAT5N_CI, a family of nonautonomous hAT-like DNA transposons from the sea squirt Ciona intestinalis
Repbase Reports 3:(6) p. 106 (2003)
There are ~50 HAT5N_CI elements in the C. intestinalis genome, they are ~85% identical to the consensus. HAT5N_CI has ~100-bp degenerative terminal inverted repeats. HAT5N_CI elements are flanked by 8-bp target site duplications. HAT5N_CI is a nonautonomous derivate of the HAT5 transposon. They share common ~100-bp 5' and ~140-bp 3' termini, respectively. The 23-bp CGTGCGTCGTAGTTTGACCTTTA minisatellite is present in HAT5N.
[1] (Consensus)
Download Sequence - Format:

© 2001-2023 - Genetic Information Research Institute