;ID ATSINE4 DNA ; ATH ; 341 BP ;XX ;DE ATSINE4, SINE-like retroelement - a consensus. ;XX ;AC . ;XX ;DT 05-NOV-2001 (Rel. 6.2, Created) ;DT 05-NOV-2001 (Rel. 6.2, Last updated, Version 1) ;XX ;KW SINE retroelement; retroposon; ATSINE4. ;XX ;OS consensus ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Plantae; Embryobionta; Magnoliophyta; Magnoliopsida; ;OC Dilleniidae; Capparales; Brassicaceae. ;XX ;RN [1] (bases 1 to 341) ;RA Kapitonov,V.V. and Jurka,J. ;RT ATSINE4, SINE-like retroelement - a consensus. ;RL Repbase Reports 1:(2) p. 40 (2001) ;XX ;CC The A.thaliana genome harbors about 10 copies of ATSINE4; ;CC they are ~90% identical to the consensus sequence, and are ;CC flanked by ~13 bp duplications of a target site. ;XX ;DR [1] (Consensus) ;XX ;SQ Sequence 341 BP; 105 A; 59 C; 90 G; 87 T; 0 other; ATSINE4 gtggaagcccccttggcccaatggttgaccaagggttcattaatgcttctacaccaagaggtctggggtt cgagtcccagctattgcgatttattagcagatttgcagattaatggaggcaagtgtgcaggagatctaca acgatgtacaattatagccgttcgccaggattctacgcagagaagatattgaaggtgtccatcaagcgca tggagaaggagaaggaggtgtcgtctgtcgtggatctaataagggtcggaaggaattgtccgtgatagaa tcgtctatgtaacagttctcataatttgtaataaataataaatctagacggcaaaaaaaaa1