;ID ATSINE3 DNA ; ATH ; 171 BP ;XX ;DE ATSINE3, SINE-like retroelement - a consensus. ;XX ;AC . ;XX ;DT 24-MAR-2000 (Rel. 5.2, Created) ;DT 24-MAR-2000 (Rel. 5.2, Last updated, Version 1) ;XX ;KW SINE retroelement; retroposon; ATSINE1; ATSINE3. ;XX ;OS consensus ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Plantae; Embryobionta; Magnoliophyta; Magnoliopsida; ;OC Dilleniidae; Capparales; Brassicaceae. ;XX ;RN [1] (bases 1 to 171) ;RA Kapitonov,V. and Jurka,J. ;RL Direct submission (March, 2000) ;XX ;CC The A.thaliana genome harbors about 100 copies of ATSINE3; ;CC they are ~91% identical to the consensus sequence, and are ;CC flanked by ~15 bp duplications of a target site. ;CC There is 69% identity between the ATSINE3 and ATSINE1 consensus ;CC sequences. ;XX ;DR [1] (Consensus) ;XX ;SQ Sequence 171 BP; 54 A; 34 C; 46 G; 37 T; 0 other; ATSINE3 accaagtgtcgttagctcaattggtaaagaccctaggcgaagcttagaggtcgccggttcgagtgacgct tgggacgaaactaatattacatgctgtggtttcgggcctggggggattacgggcttcggcccagaacctc ctggtattcaaaaaaaaaaaaaaaaaaaaaa1