;ID   ATSINE3     DNA   ; ATH   ; 171 BP
;XX
;DE   ATSINE3, SINE-like retroelement - a consensus.
;XX
;AC   .
;XX
;DT   24-MAR-2000 (Rel. 5.2, Created)
;DT   24-MAR-2000 (Rel. 5.2, Last updated, Version 1)
;XX
;KW   SINE retroelement; retroposon; ATSINE1; ATSINE3.
;XX
;OS   consensus
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Plantae; Embryobionta; Magnoliophyta; Magnoliopsida;
;OC   Dilleniidae; Capparales; Brassicaceae.
;XX
;RN   [1]  (bases 1 to 171)
;RA   Kapitonov,V. and Jurka,J.
;RL   Direct submission (March, 2000)
;XX
;CC   The A.thaliana genome harbors about 100 copies of ATSINE3;
;CC   they are ~91% identical to the consensus sequence, and are 
;CC   flanked by ~15 bp duplications of a target site. 
;CC   There is 69% identity between the ATSINE3 and ATSINE1 consensus
;CC   sequences.
;XX
;DR   [1] (Consensus)
;XX
;SQ   Sequence 171 BP; 54 A; 34 C; 46 G; 37 T; 0 other;
ATSINE3
accaagtgtcgttagctcaattggtaaagaccctaggcgaagcttagaggtcgccggttcgagtgacgct
tgggacgaaactaatattacatgctgtggtttcgggcctggggggattacgggcttcggcccagaacctc
ctggtattcaaaaaaaaaaaaaaaaaaaaaa1