;ID ATSINE1 DNA ; ATH ; 175 BP ;XX ;DE ATSINE1, SINE-like retroelement - a consensus. ;XX ;AC . ;XX ;DT 16-FEB-1999 (Rel. 3.1, Created) ;DT 16-FEB-1999 (Rel. 3.1, Last updated, Version 1) ;XX ;KW SINE retroelement; retroposon; ATSINE1. ;XX ;OS consensus ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Plantae; Embryobionta; Magnoliophyta; Magnoliopsida; ;OC Dilleniidae; Capparales; Brassicaceae. ;XX ;RN [1] (bases 1 to 175) ;RA Kapitonov,V. and Jurka,J. ;RL Direct submission (February, 1999) ;XX ;RN [2] ;RA Kapitonov,V.V. and Jurka,J. ;RT Molecular paleontology of transposable elements from ;RT Arabidopsis thaliana. ;RL Genetica 107 (1-3), 27-37 (1999) ;XX ;CC ATSINE1's individual copies are ~80% identical to the consensus ;CC sequence. Poly(A) tail and ~15 bp-long target-site duplications ;CC indicate that ATSINE1 is a SINE-like retroelement. ;CC Common structure of the 3'-tail in ATLINE1_3A and ATSINE may indicate ;CC that ATSINE1 has been transposed because of the ATLINE1 activity. ;XX ;DR [1] (Consensus) ;XX ;SQ Sequence 175 BP; 48 A; 32 C; 49 G; 43 T; 3 other; ATSINE1 accaacgtgctgttggcccagtggtaaatctyycaggtggaggtgttgggttcgaggcacgttgggaggg atctcttctccaaaagagatgaatttaacctggtgtgggtcccgcctctrggaaatgtagggcctttggg cttgaacttccagatattcaaaaaaaaaaaaaaaa1