;ID   ATSINE1     DNA   ; ATH   ; 175 BP
;XX
;DE   ATSINE1, SINE-like retroelement - a consensus.
;XX
;AC   .
;XX
;DT   16-FEB-1999 (Rel. 3.1, Created)
;DT   16-FEB-1999 (Rel. 3.1, Last updated, Version 1)
;XX
;KW   SINE retroelement; retroposon; ATSINE1.
;XX
;OS   consensus
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Plantae; Embryobionta; Magnoliophyta; Magnoliopsida;
;OC   Dilleniidae; Capparales; Brassicaceae.
;XX
;RN   [1]  (bases 1 to 175)
;RA   Kapitonov,V. and Jurka,J.
;RL   Direct submission (February, 1999)
;XX
;RN   [2]
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Molecular paleontology of transposable elements from
;RT   Arabidopsis thaliana.
;RL   Genetica 107 (1-3), 27-37 (1999)
;XX
;CC   ATSINE1's individual copies are ~80% identical to the consensus 
;CC   sequence. Poly(A) tail and ~15 bp-long target-site duplications 
;CC   indicate that ATSINE1 is a SINE-like retroelement. 
;CC   Common structure of the 3'-tail in ATLINE1_3A and ATSINE may indicate
;CC   that ATSINE1 has been transposed because of the ATLINE1 activity.
;XX
;DR   [1] (Consensus)
;XX
;SQ   Sequence 175 BP; 48 A; 32 C; 49 G; 43 T; 3 other;
ATSINE1
accaacgtgctgttggcccagtggtaaatctyycaggtggaggtgttgggttcgaggcacgttgggaggg
atctcttctccaaaagagatgaatttaacctggtgtgggtcccgcctctrggaaatgtagggcctttggg
cttgaacttccagatattcaaaaaaaaaaaaaaaa1