;ID   ATMSAT1     DNA   ; ATH   ; 97 BP
;XX
;DE   ATMSAT1, a mini-satellite repeat - a consensus.
;XX
;AC   .
;XX
;DT   17-MAR-1999 (Rel. 3.2, Created)
;DT   17-MAR-1999 (Rel. 3.2, Last updated, Version 1)
;XX
;KW   tandem repeat; satellite; ATMSAT1.
;XX
;OS   consensus
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Plantae; Embryobionta; Magnoliophyta; Magnoliopsida;
;OC   Dilleniidae; Capparales; Brassicaceae.
;XX
;RN   [1]  (bases 1 to 97)
;RA   Kapitonov,V. and Jurka,J.
;RL   Direct submission (March 1999)
;XX
;CC   ATMSAT1 is a mini-satellite-like repeat. There are several hundred
;CC   copies of the repeat co-clustered together with AR12 repeat. 
;CC   Its individual copies are ~95% identical to the consensus 
;CC   sequence.
;XX
;DR   [1] (Consensus)
;XX
;SQ   Sequence 97 BP; 34 A; 15 C; 21 G; 27 T; 0 other;
ATMSAT1
tttttccaagaggtggaacttggaaaaatccttgagggatgaaatctagtcttgtgaagagcgaactcaa
cacttagatttcaccgaaatgaatata1