;ID ATMSAT1 DNA ; ATH ; 97 BP ;XX ;DE ATMSAT1, a mini-satellite repeat - a consensus. ;XX ;AC . ;XX ;DT 17-MAR-1999 (Rel. 3.2, Created) ;DT 17-MAR-1999 (Rel. 3.2, Last updated, Version 1) ;XX ;KW tandem repeat; satellite; ATMSAT1. ;XX ;OS consensus ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Plantae; Embryobionta; Magnoliophyta; Magnoliopsida; ;OC Dilleniidae; Capparales; Brassicaceae. ;XX ;RN [1] (bases 1 to 97) ;RA Kapitonov,V. and Jurka,J. ;RL Direct submission (March 1999) ;XX ;CC ATMSAT1 is a mini-satellite-like repeat. There are several hundred ;CC copies of the repeat co-clustered together with AR12 repeat. ;CC Its individual copies are ~95% identical to the consensus ;CC sequence. ;XX ;DR [1] (Consensus) ;XX ;SQ Sequence 97 BP; 34 A; 15 C; 21 G; 27 T; 0 other; ATMSAT1 tttttccaagaggtggaacttggaaaaatccttgagggatgaaatctagtcttgtgaagagcgaactcaa cacttagatttcaccgaaatgaatata1