;ID ATCOPIA94LTR DNA ; ATH ; 150 BP ;XX ;DE Putative long terminal repeat from the ATCOPIA94 copia-like ;DE LTR-retrotransposon. ;XX ;AC AC022354 ;XX ;DT 27-DEC-2001 (Rel. 6.3, Created) ;DT 27-DEC-2001 (Rel. 6.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; long terminal repeat; ;KW the ATCOPIA94 family; ATCOPIA94_I; ATCOPIA94LTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 150) ;RA Kapitonov,V.V. and Jurka,J. ;RT Long terminal repeat from the ATCOPIA94 copia-like LTR-retrotransposon. ;RL Repbase Reports 1:(4) p. 3 (2001) ;XX ;CC See comments for ATCOPIA94_I. ;XX ;DR Positions 36917 37066 Accession No AC022354 GenBank (rel. 124.0) ;XX ;SQ Sequence 150 BP; 50 A; 23 C; 20 G; 57 T; 0 other; ATCOPIA94LTR tattgagaatatctttgatattctcatatcttagtaaatattctctatacatatatgttgtaactagtta agggatattcgattaggttttatgcacatactctcttgtataaatagaaggctcagcctccgttaataaa caacacatta1