;ID   ATCOPIA94LTR DNA   ; ATH   ; 150 BP
;XX
;DE   Putative long terminal repeat from the ATCOPIA94 copia-like 
;DE   LTR-retrotransposon.
;XX
;AC   AC022354
;XX
;DT   27-DEC-2001 (Rel. 6.3, Created)
;DT   27-DEC-2001 (Rel. 6.3, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; long terminal repeat; 
;KW   the ATCOPIA94 family; ATCOPIA94_I; ATCOPIA94LTR.
;XX
;OS   Arabidopsis thaliana
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
;OC   euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons;
;OC   Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1] (bases 1 to 150)
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Long terminal repeat from the ATCOPIA94 copia-like LTR-retrotransposon.
;RL   Repbase Reports 1:(4) p. 3 (2001)
;XX
;CC   See comments for ATCOPIA94_I.
;XX
;DR   Positions  36917  37066  Accession No AC022354    GenBank (rel. 124.0)
;XX
;SQ   Sequence 150 BP; 50 A; 23 C; 20 G; 57 T; 0 other;
ATCOPIA94LTR
tattgagaatatctttgatattctcatatcttagtaaatattctctatacatatatgttgtaactagtta
agggatattcgattaggttttatgcacatactctcttgtataaatagaaggctcagcctccgttaataaa
caacacatta1