;ID   ATCOPIA92LTR DNA   ; ATH   ; 133 BP
;XX
;DE   Long terminal repeat from the ATCOPIA92 copia-like 
;DE   LTR-retrotransposon.
;XX
;AC   AF262038
;XX
;DT   30-NOV-2001 (Rel. 6.3, Created)
;DT   30-NOV-2001 (Rel. 6.3, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; long terminal repeat; 
;KW   the ATCOPIA92 family; ATCOPIA92_I; ATCOPIA92LTR.
;XX
;OS   Arabidopsis thaliana
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
;OC   euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons;
;OC   Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1] (bases 1 to 133)
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Long terminal repeat from the ATCOPIA92 copia-like LTR-retrotransposon.
;RL   Repbase Reports 1:(3) p. 27 (2001)
;XX
;CC   See comments for ATCOPIA92_I.
;XX
;DR   Positions 46391 46259  Accession No AF262038    GenBank (rel. 124.0)
;XX
;SQ   Sequence 133 BP; 48 A; 17 C; 18 G; 50 T; 0 other;
ATCOPIA92LTR
tatagaagtataagtatgtaataagttaagggatctaattgtaattaactttgatcctaataccctagac
gactcatgtatatattgatgtaatctctcttttagtgataataagaatcattcaatccttata1