;ID ATCOPIA92LTR DNA ; ATH ; 133 BP ;XX ;DE Long terminal repeat from the ATCOPIA92 copia-like ;DE LTR-retrotransposon. ;XX ;AC AF262038 ;XX ;DT 30-NOV-2001 (Rel. 6.3, Created) ;DT 30-NOV-2001 (Rel. 6.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; long terminal repeat; ;KW the ATCOPIA92 family; ATCOPIA92_I; ATCOPIA92LTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 133) ;RA Kapitonov,V.V. and Jurka,J. ;RT Long terminal repeat from the ATCOPIA92 copia-like LTR-retrotransposon. ;RL Repbase Reports 1:(3) p. 27 (2001) ;XX ;CC See comments for ATCOPIA92_I. ;XX ;DR Positions 46391 46259 Accession No AF262038 GenBank (rel. 124.0) ;XX ;SQ Sequence 133 BP; 48 A; 17 C; 18 G; 50 T; 0 other; ATCOPIA92LTR tatagaagtataagtatgtaataagttaagggatctaattgtaattaactttgatcctaataccctagac gactcatgtatatattgatgtaatctctcttttagtgataataagaatcattcaatccttata1