;ID ATCOPIA90LTR DNA ; ATH ; 130 BP ;XX ;DE Long terminal repeat from the ATCOPIA90 copia-like ;DE LTR-retrotransposon. ;XX ;AC AC069326 ;XX ;DT 30-NOV-2001 (Rel. 6.3, Created) ;DT 30-NOV-2001 (Rel. 6.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; long terminal repeat; ;KW the ATCOPIA90 family; ATCOPIA90_I; ATCOPIA90LTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 130) ;RA Kapitonov,V.V. and Jurka,J. ;RT Long terminal repeat from the ATCOPIA90 copia-like LTR-retrotransposon. ;RL Repbase Reports 1:(3) p. 23 (2001) ;XX ;CC See comments for ATCOPIA90_I. ;XX ;DR Positions 30374 30245 Accession No AC069326 GenBank (rel. 124.0) ;XX ;SQ Sequence 130 BP; 42 A; 12 C; 16 G; 60 T; 0 other; ATCOPIA90LTR tattaacatataatgtatagttatatatgttgttgagttagttatagtattaagtctcctttagcttgat actatatatactctattgtatgattcattttactttaatgagaaaatcactttgttaata1