;ID   ATCOPIA90LTR DNA   ; ATH   ; 130 BP
;XX
;DE   Long terminal repeat from the ATCOPIA90 copia-like 
;DE   LTR-retrotransposon.
;XX
;AC   AC069326
;XX
;DT   30-NOV-2001 (Rel. 6.3, Created)
;DT   30-NOV-2001 (Rel. 6.3, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; long terminal repeat; 
;KW   the ATCOPIA90 family; ATCOPIA90_I; ATCOPIA90LTR.
;XX
;OS   Arabidopsis thaliana
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
;OC   euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons;
;OC   Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1] (bases 1 to 130)
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Long terminal repeat from the ATCOPIA90 copia-like LTR-retrotransposon.
;RL   Repbase Reports 1:(3) p. 23 (2001)
;XX
;CC   See comments for ATCOPIA90_I.
;XX
;DR   Positions 30374 30245  Accession No AC069326    GenBank (rel. 124.0)
;XX
;SQ   Sequence 130 BP; 42 A; 12 C; 16 G; 60 T; 0 other;
ATCOPIA90LTR
tattaacatataatgtatagttatatatgttgttgagttagttatagtattaagtctcctttagcttgat
actatatatactctattgtatgattcattttactttaatgagaaaatcactttgttaata1