;ID   ATCOPIA85LTR DNA   ; ATH   ; 128 BP
;XX
;DE   Long terminal repeat from the ATCOPIA85 copia-like 
;DE   LTR-retrotransposon.
;XX
;AC   AB025622
;XX
;DT   30-NOV-2001 (Rel. 6.3, Created)
;DT   30-NOV-2001 (Rel. 6.3, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; long terminal repeat; 
;KW   the ATCOPIA85 family; ATCOPIA85_I; ATCOPIA85LTR.
;XX
;OS   Arabidopsis thaliana
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
;OC   euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons;
;OC   Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1] (bases 1 to 128)
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Long terminal repeat from the ATCOPIA85 copia-like LTR-retrotransposon.
;RL   Repbase Reports 1:(3) p. 13 (2001)
;XX
;CC   See comments for ATCOPIA85_I.
;XX
;DR   Positions 23173 23300  Accession No AB025622    GenBank (rel. 124.0)
;XX
;SQ   Sequence 128 BP; 51 A; 13 C; 17 G; 47 T; 0 other;
ATCOPIA85LTR
tattagatatatcatatagtgtatatacttaggcttatacatgtaattaatgtccactatataaggtgac
aatgtacagaactttatgattaatgagaataagaagtttaataatctcaatcttaata1