;ID ATCOPIA85LTR DNA ; ATH ; 128 BP ;XX ;DE Long terminal repeat from the ATCOPIA85 copia-like ;DE LTR-retrotransposon. ;XX ;AC AB025622 ;XX ;DT 30-NOV-2001 (Rel. 6.3, Created) ;DT 30-NOV-2001 (Rel. 6.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; long terminal repeat; ;KW the ATCOPIA85 family; ATCOPIA85_I; ATCOPIA85LTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 128) ;RA Kapitonov,V.V. and Jurka,J. ;RT Long terminal repeat from the ATCOPIA85 copia-like LTR-retrotransposon. ;RL Repbase Reports 1:(3) p. 13 (2001) ;XX ;CC See comments for ATCOPIA85_I. ;XX ;DR Positions 23173 23300 Accession No AB025622 GenBank (rel. 124.0) ;XX ;SQ Sequence 128 BP; 51 A; 13 C; 17 G; 47 T; 0 other; ATCOPIA85LTR tattagatatatcatatagtgtatatacttaggcttatacatgtaattaatgtccactatataaggtgac aatgtacagaactttatgattaatgagaataagaagtttaataatctcaatcttaata1