;ID   ATCOPIA84LTR DNA   ; ATH   ; 156 BP
;XX
;DE   Long terminal repeat from the ATCOPIA84 copia-like 
;DE   LTR-retrotransposon.
;XX
;AC   AC027032
;XX
;DT   30-NOV-2001 (Rel. 6.3, Created)
;DT   30-NOV-2001 (Rel. 6.3, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; long terminal repeat; 
;KW   the ATCOPIA84 family; ATCOPIA84_I; ATCOPIA84LTR.
;XX
;OS   Arabidopsis thaliana
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
;OC   euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons;
;OC   Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1] (bases 1 to 156)
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Long terminal repeat from the ATCOPIA84 copia-like LTR-retrotransposon.
;RL   Repbase Reports 1:(3) p. 11 (2001)
;XX
;CC   See comments for ATCOPIA84_I.
;XX
;DR   Positions  29219 29374  Accession No AC027032    GenBank (rel. 124.0)
;XX
;SQ   Sequence 156 BP; 56 A; 17 C; 14 G; 69 T; 0 other;
ATCOPIA84LTR
tataaaagtatatatatacatatatatatatatatatatgttaacacttagttaagagtgtttatgtaat
tagttttaccttaatcacttcttagtctctgtatatatatgtgtactttccattactatgaataataaga
attactattctctata1