;ID ATCOPIA84LTR DNA ; ATH ; 156 BP ;XX ;DE Long terminal repeat from the ATCOPIA84 copia-like ;DE LTR-retrotransposon. ;XX ;AC AC027032 ;XX ;DT 30-NOV-2001 (Rel. 6.3, Created) ;DT 30-NOV-2001 (Rel. 6.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; long terminal repeat; ;KW the ATCOPIA84 family; ATCOPIA84_I; ATCOPIA84LTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 156) ;RA Kapitonov,V.V. and Jurka,J. ;RT Long terminal repeat from the ATCOPIA84 copia-like LTR-retrotransposon. ;RL Repbase Reports 1:(3) p. 11 (2001) ;XX ;CC See comments for ATCOPIA84_I. ;XX ;DR Positions 29219 29374 Accession No AC027032 GenBank (rel. 124.0) ;XX ;SQ Sequence 156 BP; 56 A; 17 C; 14 G; 69 T; 0 other; ATCOPIA84LTR tataaaagtatatatatacatatatatatatatatatatgttaacacttagttaagagtgtttatgtaat tagttttaccttaatcacttcttagtctctgtatatatatgtgtactttccattactatgaataataaga attactattctctata1