;ID   ATCOPIA83LTR DNA   ; ATH   ; 140 BP
;XX
;DE   Long terminal repeat from the ATCOPIA83 copia-like 
;DE   LTR-retrotransposon.
;XX
;AC   AB010694
;XX
;DT   30-NOV-2001 (Rel. 6.3, Created)
;DT   30-NOV-2001 (Rel. 6.3, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; long terminal repeat; 
;KW   the ATCOPIA83 family; ATCOPIA83_I; ATCOPIA83LTR.
;XX
;OS   Arabidopsis thaliana
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
;OC   euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons;
;OC   Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1] (bases 1 to 140)
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Long terminal repeat from the ATCOPIA83 copia-like LTR-retrotransposon.
;RL   Repbase Reports 1:(3) p. 9 (2001)
;XX
;CC   See comments for ATCOPIA83_I.
;XX
;DR   Positions  9707  9568  Accession No AB010694    GenBank (rel. 124.0)
;XX
;SQ   Sequence 140 BP; 33 A; 32 C; 23 G; 52 T; 0 other;
ATCOPIA83LTR
tattgggctatgaggcctctcccgagcccacttagattgtatagctacactaggttaaatcatgttgttg
tatataaggcattgcctctcttacgtatcaacttgaaacgtctttttacatcttcatctcctttttgaca
1