;ID ATCOPIA83LTR DNA ; ATH ; 140 BP ;XX ;DE Long terminal repeat from the ATCOPIA83 copia-like ;DE LTR-retrotransposon. ;XX ;AC AB010694 ;XX ;DT 30-NOV-2001 (Rel. 6.3, Created) ;DT 30-NOV-2001 (Rel. 6.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; long terminal repeat; ;KW the ATCOPIA83 family; ATCOPIA83_I; ATCOPIA83LTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 140) ;RA Kapitonov,V.V. and Jurka,J. ;RT Long terminal repeat from the ATCOPIA83 copia-like LTR-retrotransposon. ;RL Repbase Reports 1:(3) p. 9 (2001) ;XX ;CC See comments for ATCOPIA83_I. ;XX ;DR Positions 9707 9568 Accession No AB010694 GenBank (rel. 124.0) ;XX ;SQ Sequence 140 BP; 33 A; 32 C; 23 G; 52 T; 0 other; ATCOPIA83LTR tattgggctatgaggcctctcccgagcccacttagattgtatagctacactaggttaaatcatgttgttg tatataaggcattgcctctcttacgtatcaacttgaaacgtctttttacatcttcatctcctttttgaca 1