;ID ATCOPIA75LTR DNA ; ATH ; 129 BP ;XX ;DE Long terminal repeat of the ATCOPIA75 copia-like LTR-retrotransposon. ;XX ;AC AC002391 ;XX ;DT 26-OCT-2001 (Rel. 6.2, Created) ;DT 26-OCT-2001 (Rel. 6.2, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; ;KW ATCOPIA75_I; ATCOPIA75LTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] ;RA Lin,X. ;RL Direct submission in GenBank (March 2000) ;XX ;RN [2] (bases 1 to 129) ;RA Kapitonov,V.V. and Jurka,J. ;RL Direct submission (August 14, 2001) ;XX ;CC ATCOPIA75LTR was found by [1]. Its exact termini were defined ;CC by [2]. ;XX ;DR Positions 91214 91086 Accession No AC002391 GenBank (rel. 124.0) ;XX ;SQ Sequence 129 BP; 42 A; 23 C; 14 G; 50 T; 0 other; ATCOPIA75LTR tattagagtagatacgatatatgtaaatcctagatttactagatacgttcttatcttctatgagcaactc tccttgtataaatactctcttcgactattggaataaacacacttttacattatatttca1