;ID ATCOPIA5LTR DNA ; ATH ; 111 BP ;XX ;DE Long terminal repeat from ATCOPIA5 retrotransposon. ;XX ;AC AC005966 ;XX ;DT 12-APR-1999 (Rel. 3.3, Created) ;DT 12-APR-1999 (Rel. 3.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; internal region; ATCOPIA5I; ;KW ATCOPIA5LTR. ;XX ;OS thale cress ;XX ;OC Arabidopsis thaliana ;OC Eukaryotae; Viridiplantae; Charophyta/Embryophyta group; ;OC Embryophyta; Tracheophyta; seed plants; Magnoliophyta; ;OC eudicotyledons; Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 111) ;RA Kapitonov,V.V. and Jurka,J. ;RL Direct submission (March 1999) ;XX ;RN [2] ;RA Kapitonov,V.V. and Jurka,J. ;RT Molecular paleontology of transposable elements from ;RT Arabidopsis thaliana. ;RL Genetica 107 (1-3), 27-37 (1999) ;XX ;CC There are only several copies of this LTR in the A.thaliana ;CC genome and they have 5 bp-long target site duplications. ;XX ;DR Positions 33133 33023 Accession No AC005966 GenBank (rel. 109.0) ;XX ;SQ Sequence 111 BP; 37 A; 16 C; 15 G; 43 T; 0 other; ATCOPIA5LTR tatagaggttatgtatagttagggtataattgtaattagtattaccctaatctctcgtgtatatatattg taatcacaacctctaatgataattaagcttcacactctata1