;ID   ATCOPIA5LTR DNA   ; ATH   ; 111 BP
;XX
;DE   Long terminal repeat from ATCOPIA5 retrotransposon.
;XX
;AC   AC005966
;XX
;DT   12-APR-1999 (Rel. 3.3, Created)
;DT   12-APR-1999 (Rel. 3.3, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; internal region; ATCOPIA5I;
;KW   ATCOPIA5LTR.
;XX
;OS   thale cress
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryotae; Viridiplantae; Charophyta/Embryophyta group;
;OC   Embryophyta; Tracheophyta; seed plants; Magnoliophyta;
;OC   eudicotyledons; Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1]  (bases 1 to 111)
;RA   Kapitonov,V.V. and Jurka,J.
;RL   Direct submission (March 1999)
;XX
;RN   [2]
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Molecular paleontology of transposable elements from
;RT   Arabidopsis thaliana.
;RL   Genetica 107 (1-3), 27-37 (1999)
;XX
;CC   There are only several copies of this LTR in the A.thaliana
;CC   genome and they have 5 bp-long target site duplications.
;XX
;DR   Positions  33133   33023  Accession No AC005966     GenBank (rel. 109.0)
;XX
;SQ   Sequence 111 BP; 37 A; 16 C; 15 G; 43 T; 0 other;
ATCOPIA5LTR
tatagaggttatgtatagttagggtataattgtaattagtattaccctaatctctcgtgtatatatattg
taatcacaacctctaatgataattaagcttcacactctata1