;ID   ATCOPIA1LTR DNA   ; ATH   ; 215 BP
;XX
;DE   Long terminal repeat from ATCOPIA1 retrotransposon.
;XX
;AC   Z97343
;XX
;DT   04-MAR-1999 (Rel. 3.2, Created)
;DT   04-MAR-1999 (Rel. 3.2, Last updated, Version 1)
;XX
;KW   LTR-retrotransposon; COPIA superfamily; LTR; ATCOPIA1I; ATCOPIA1LTR.
;XX
;OS   thale cress.
;XX
;OC   Arabidopsis thaliana
;OC   Eukaryotae; Viridiplantae; Charophyta/Embryophyta group;
;OC   Embryophyta; Tracheophyta; seed plants; Magnoliophyta;
;OC   eudicotyledons; Rosidae; Capparales; Brassicaceae; Arabidopsis.
;XX
;RN   [1]  (bases 1 to 207674)
;RA   Bevan,M., Bancroft,I., Bent,E., Love,K., Goodman,H., Dean,C.,
;RA   Bergkamp,R., Dirkse,W., Van Staveren,M., Stiekema,W., Drost,L.,
;RA   Ridley,P., Hudson,S.A., Patel,K., Murphy,G., Piffanelli,P.,
;RA   Wedler,H., Wedler,E., Wambutt,R., Weitzenegger,T., Pohl,T.M.,
;RA   Terryn,N., Gielen,J., Villarroel,R., De Clerck,R., Van Montagu,M.,
;RA   Lecharny,A., Auborg,S., Gy,I., Kreis,M., Lao,N., Kavanagh,T.,
;RA   Hempel,S., Kotter,P., Entian,K.D., Rieger,M., Schaeffer,M.,
;RA   Funk,B., Mueller-Auer,S., Silvey,M., James,R., Montfort,A.,
;RA   Pons,A., Puigdomenech,P., Douka,A., Voukelatou,E., Milioni,D.,
;RA   Hatzopoulos,P., Piravandi,E., Obermaier,B., Hilbert,H.,
;RA   Duesterhoft,A., Moores,T., Jones,J.D.G., Eneva,T., Palme,K.,
;RA   Benes,V., Rechman,S., Ansorge,W., Cooke,R., Berger,C., Delseny,M.,
;RA   Voet,M., Volckaert,G., Mewes,H.W., Klosterman,S., Schueller,C.
;RA   and Chalwatzis,N.
;RT   Analysis of 1.9 Mb of contiguous sequence from chromosome 4 of
;RT   Arabidopsis thaliana
;RL   Nature 391 (6666), 485-488 (1998)
;RL   MEDLINE   98121113
;XX
;RN   [2]  (bases 1 to 207674)
;RA   EU Arabidopsis sequencing, project and ESSA.
;RT   Direct Submission
;RL   Submitted (19-JUN-1997) MIPS, at the Max-Planck-Institut fuer
;RL   Biochemie, Am Klopferspitz 18a, D-82152 Martinsried, FRG, Project
;RL   Coordinator: Mike Bevan, Molecular Genetics Department, Cambridge
;RL   Laboratory, John Innes Centre, Colney Lane, NR4 7UJ Norwich, UK,
;RL   E-mail: michael.bevan@bbsrc.ac.uk
;XX
;RN   [3]
;RA   Kapitonov,V.V. and Jurka,J.
;RT   Molecular paleontology of transposable elements from
;RT   Arabidopsis thaliana.
;RL   Genetica 107 (1-3), 27-37 (1999)
;XX
;CC   There are only several copies of this LTR in the A.thaliana
;CC   genome and they have 5 bp-long target site duplications
;CC   (Kapitonov,V.V. and Jurka,J.).
;XX
;DR   Positions  102504  102290  Accession No Z97343       GenBank (rel. 109.0)
;XX
;SQ   Sequence 215 BP; 58 A; 29 C; 37 G; 91 T; 0 other;
ATCOPIA1LTR
tattagcttatatatatttagtctatacttgtatataatagcagtgattaagggttcggtatagtcccgg
tttattcatctaattaaggtgaatctctggtttattattggtttagttggtttgttgtctatacaacatt
gtaacaaactttcaagattattaatgagaaattgagctttcaccatgttttctctctcgagcatggttcc
tatta1