;ID ATCOPIA1LTR DNA ; ATH ; 215 BP ;XX ;DE Long terminal repeat from ATCOPIA1 retrotransposon. ;XX ;AC Z97343 ;XX ;DT 04-MAR-1999 (Rel. 3.2, Created) ;DT 04-MAR-1999 (Rel. 3.2, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; LTR; ATCOPIA1I; ATCOPIA1LTR. ;XX ;OS thale cress. ;XX ;OC Arabidopsis thaliana ;OC Eukaryotae; Viridiplantae; Charophyta/Embryophyta group; ;OC Embryophyta; Tracheophyta; seed plants; Magnoliophyta; ;OC eudicotyledons; Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 207674) ;RA Bevan,M., Bancroft,I., Bent,E., Love,K., Goodman,H., Dean,C., ;RA Bergkamp,R., Dirkse,W., Van Staveren,M., Stiekema,W., Drost,L., ;RA Ridley,P., Hudson,S.A., Patel,K., Murphy,G., Piffanelli,P., ;RA Wedler,H., Wedler,E., Wambutt,R., Weitzenegger,T., Pohl,T.M., ;RA Terryn,N., Gielen,J., Villarroel,R., De Clerck,R., Van Montagu,M., ;RA Lecharny,A., Auborg,S., Gy,I., Kreis,M., Lao,N., Kavanagh,T., ;RA Hempel,S., Kotter,P., Entian,K.D., Rieger,M., Schaeffer,M., ;RA Funk,B., Mueller-Auer,S., Silvey,M., James,R., Montfort,A., ;RA Pons,A., Puigdomenech,P., Douka,A., Voukelatou,E., Milioni,D., ;RA Hatzopoulos,P., Piravandi,E., Obermaier,B., Hilbert,H., ;RA Duesterhoft,A., Moores,T., Jones,J.D.G., Eneva,T., Palme,K., ;RA Benes,V., Rechman,S., Ansorge,W., Cooke,R., Berger,C., Delseny,M., ;RA Voet,M., Volckaert,G., Mewes,H.W., Klosterman,S., Schueller,C. ;RA and Chalwatzis,N. ;RT Analysis of 1.9 Mb of contiguous sequence from chromosome 4 of ;RT Arabidopsis thaliana ;RL Nature 391 (6666), 485-488 (1998) ;RL MEDLINE 98121113 ;XX ;RN [2] (bases 1 to 207674) ;RA EU Arabidopsis sequencing, project and ESSA. ;RT Direct Submission ;RL Submitted (19-JUN-1997) MIPS, at the Max-Planck-Institut fuer ;RL Biochemie, Am Klopferspitz 18a, D-82152 Martinsried, FRG, Project ;RL Coordinator: Mike Bevan, Molecular Genetics Department, Cambridge ;RL Laboratory, John Innes Centre, Colney Lane, NR4 7UJ Norwich, UK, ;RL E-mail: michael.bevan@bbsrc.ac.uk ;XX ;RN [3] ;RA Kapitonov,V.V. and Jurka,J. ;RT Molecular paleontology of transposable elements from ;RT Arabidopsis thaliana. ;RL Genetica 107 (1-3), 27-37 (1999) ;XX ;CC There are only several copies of this LTR in the A.thaliana ;CC genome and they have 5 bp-long target site duplications ;CC (Kapitonov,V.V. and Jurka,J.). ;XX ;DR Positions 102504 102290 Accession No Z97343 GenBank (rel. 109.0) ;XX ;SQ Sequence 215 BP; 58 A; 29 C; 37 G; 91 T; 0 other; ATCOPIA1LTR tattagcttatatatatttagtctatacttgtatataatagcagtgattaagggttcggtatagtcccgg tttattcatctaattaaggtgaatctctggtttattattggtttagttggtttgttgtctatacaacatt gtaacaaactttcaagattattaatgagaaattgagctttcaccatgttttctctctcgagcatggttcc tatta1