;ID ATCOPIA18ALTR DNA ; ATH ; 103 BP ;XX ;DE Long terminal repeat from the ATCOPIA18A copia-like ;DE LTR-retrotransposon. ;XX ;AC AB025602 ;XX ;DT 30-NOV-2001 (Rel. 6.3, Created) ;DT 30-NOV-2001 (Rel. 6.3, Last updated, Version 1) ;XX ;KW LTR-retrotransposon; COPIA superfamily; long terminal repeat; ;KW the ATCOPIA18 family; ATCOPIA18A_I; ATCOPIA18ALTR. ;XX ;OS Arabidopsis thaliana ;XX ;OC Arabidopsis thaliana ;OC Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; ;OC euphyllophytes; Spermatophyta; Magnoliophyta; eudicotyledons; ;OC Rosidae; Capparales; Brassicaceae; Arabidopsis. ;XX ;RN [1] (bases 1 to 103) ;RA Kapitonov,V.V. and Jurka,J. ;RT Long terminal repeat from the ATCOPIA18A copia-like LTR-retrotransposon. ;RL Repbase Reports 1:(3) p. 2 (2001) ;XX ;CC See comments for ATCOPIA18A_I. ;XX ;DR Positions 54161 54059 Accession No AB025602 GenBank (rel. 124.0) ;XX ;SQ Sequence 103 BP; 38 A; 11 C; 14 G; 40 T; 0 other; ATCOPIA18ALTR tattaagctataaagtagaataagtctcctttagcttatctattatatatatgaatgtaatgtcacattt gaggtttaatgagaaattcacaatctgttaata1