Repbase Reports |
|---|
| 2012, Volume 12, Issue 8 |
| August 31, 2012 |
| Copyright © 2001-2012 - Genetic Information Research Institute, Mountain View, California |
| ISSN# 1534-830X |
| Page 1638 |
LT1_EPa |
|||
|---|---|---|---|
Short LTR retrotransposon from the Eutrema parvulum genome: consensus. |
|||
|
Submitted: 02-Sep-2011 |
Accepted: 20-AUG-2012 |
||
|
Key Words: LTR Retrotransposon; Transposable Element; LT1_EPa |
|||
|
Source: Eutrema parvulum |
Organism: Eutrema parvulum |
Taxonomy: Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; rosids; malvids; Brassicales; Brassicaceae; Eutremeae; Eutrema |
|
| [2] |
Authors: Jurka,J. |
||
|
Title: LTR retrotransposons from the Eutrema parvulum genome. |
|||
|
Journal: Repbase Reports 12(8), 1638-1638 (2012) |
|||
Abstract: >89% identical to consensus. 5bp TSD. The element is complete, with short internal portion flanked by LTRs. The internal portion: tggtatcagagcccgatccacacactcttgtaatccggcccaaaaagtggtccgtgctcctggacccgaaattgatggtctggcgagattaatggctagaagagccattatctcgagggggag.
|
|||
|
Derived: [2] (Consensus) |
|||
|
Download Sequence - Format: IG, EMBL, FASTA |
|||
References:
|
|||